Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
    BLV

PKB-number: PKB1
Definition: Gag/pro ribosomal frameshift site of Bovine Leukemia Virus
Organism: Bovine Leukemia Virus
Abbreviation: BLV
RNA type:  Viral ribosomal frameshifting
Keywords: retroviridae; ribosomal frameshift; gag-pro
EMBL number:  AF033818
Submitted by:  J. Ng ( JackTown@Hotmail.com)
Supported by:  Sequence comparison
References: [1] ten Dam,E., Pleij,C.W.A. & Bosch,L.(1990). Virus Genes 4, 121-136.
[2] Sagata,N. et al.(1985). Proc.Natl.Acad.Sci.USA 82, 677-681.
[3] Rice,N.R. et al.(1985). Virology 142, 357-377.
Stem sizes:
Loop sizes:
6 3
5 0 4
Position Paired: 
1604-1609; 1618-1623
1615-1617; 1628-1630
Bracket view of structure:
         1590      1600      1610      1620      1630
     #      |123456789|123456789|123456789|123456789|123456
     $ 1590 AAAAAACUAAUAGAGGGGGGACUUAGCGCCCCCCAAACCGUAACCCC=1636
     % 1590 ::::::::::::::[[[[[[:::::(((]]]]]]::::)))::::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1998-2-24/.../1999-2-3 PKB00001.html