Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BWYV

PKB-number: PKB2
Modification:  1999-6-21
Definition: Orf2-orf3 ribosomal frameshift site of Beet Western Yellows Virus
Organism: Beet Western-Yellows Virus
Abbreviation: BWYV
RNA type:  Viral ribosomal frameshifting
Keywords: luteoviridae; ribosomal frameshift; orf2-orf3
EMBL number: X13063
Submitted by: J. Ng ( JackTown@Hotmail.com)
Supported by:  Sequence comparison; mutagenesis; crystal structure
References: [1] Garcia,A., van Duin,J. & Pleij,C.W.A.(1993). Nucleic Acids.Res. 21, 401-406.
[2] Veidt,I. et al.(1988). Nucleic Acids Res 16, 9917-9932.
[3] Su,L., Chen,L., Egli,M., Berger,J.M. & Rich,A.(1999). Nature Struct. Biol. 6, 285-292.
Comment: According to crystal structure [3], the residue U1576 is bulged out whereas A1588 is tilted and forms H-bonds with bases in different layers at the stem junction.
Stem sizes:
Loop sizes:
5 4
2 0 6
Position Paired:
1566-1570; 1577-1581
1573-1576; 1588-1591
Bracket view of structure:
                1560      1570      1580      1590      1600
     #      3456789|123456789|123456789|123456789|123456789|12
     $ 1553 GGGAAACGGAGUGCGCGGCACCGUCCGCGGAACAAACGGAGAAGGCAGCU=1602
     % 1553 :::::::::::::[[[[[::((((]]]]]::::::)))):::::::::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1998-2-24/.../1999-2-3 PKB00002.html