 |
Intro | |||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | ||||
| BWYV | 
| ||||
| PKB-number: | PKB2 |
| Modification: | 1999-6-21 |
| Definition: | Orf2-orf3 ribosomal frameshift site of Beet Western Yellows Virus |
| Organism: | Beet Western-Yellows Virus |
| Abbreviation: | BWYV |
| RNA type: | Viral ribosomal frameshifting |
| Keywords: | luteoviridae; ribosomal frameshift; orf2-orf3 |
| EMBL number: | X13063 |
| Submitted by: | J. Ng ( JackTown@Hotmail.com) |
| Supported by: | Sequence comparison; mutagenesis; crystal structure |
| References: |
[1] Garcia,A., van Duin,J. & Pleij,C.W.A.(1993). Nucleic Acids.Res. 21, 401-406.
[2] Veidt,I. et al.(1988). Nucleic Acids Res 16, 9917-9932. [3] Su,L., Chen,L., Egli,M., Berger,J.M. & Rich,A.(1999). Nature Struct. Biol. 6, 285-292. |
| Comment: | According to crystal structure [3], the residue U1576 is bulged out whereas A1588 is tilted and forms H-bonds with bases in different layers at the stem junction. |
| Stem sizes: Loop sizes: |
5 4 2 0 6 |
| Position Paired: | 1566-1570; 1577-1581 1573-1576; 1588-1591 |
| Bracket view of structure: |
1560 1570 1580 1590 1600
# 3456789|123456789|123456789|123456789|123456789|12
$ 1553 GGGAAACGGAGUGCGCGGCACCGUCCGCGGAACAAACGGAGAAGGCAGCU=1602
% 1553 :::::::::::::[[[[[::((((]]]]]::::::)))):::::::::::