Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
EIAV

PKB-number: PKB3
Definition: Gag-pol ribosomal frameshift site of Equine Infectious Anemia Virus
Organism: Equine Infectious Anemic Virus
Abbreviation: EIAV
RNA type: Viral ribosomal frameshifting
Keywords: retroviridae; ribosomal frameshift; gag-pol
EMBL number: AF033820
Submitted by: J. Ng ( JackTown@Hotmail.com)
Supported by: Sequence comparison
References: [1] ten Dam E., Pleij C.W.A., & Bosch L.(1990). Virus Genes 1990, 4, 121-136.
[2] Stephens,R.M., et al.(1986). Science 231, 589-594.
Stem sizes:
Loop sizes:
6 4
3 0 12
Position Paired:
1797-1802; 1810-1815
1806-1809; 1828-1831
Bracket view of structure:
                  1790      1800      1810      1820      1830
     #      123456789|123456789|123456789|123456789|123456789|1234
     $ 1781 AAAAAACGGGAAGCAAGGGGCUCAAGGGAGGCCCCAGAAACAAACUUUCCCGAU=1834
     % 1781 ::::::::::::::::[[[[[[:::((((]]]]]]::::::::::::)))):::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1998-2-24/.../1999-2-3 PKB00003.html