Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
FIV

PKB-number: PKB4
Definition: Gag-pol ribosomal frameshift site of Feline Immunodeficiency Virus
Organism: Feline Immunodeficiency Virus
Abbreviation: FIV
RNA type: Viral ribosomal frameshifting
Keywords: retroviridae; ribosomal frameshift; gag-pol
EMBL number: M25381
Submitted by: J. Ng ( JackTown@Hotmail.com)
Supported by: Sequence comparison
References: [1] ten Dam E., Pleij C.W.A., & Bosch L.(1990). Virus Genes 4, 121-136.
[2] Talbot et al.(1989). Proc.Natl.Acad.Sci.USA 86, 5743-5747.
[3] Phillips,T.R. et al. (1990). J.Virol. 64, 4605-4613.
Comment: The sequence below is given for so-called Petaluma isolate [2]. In the PPR-isolate [3], the A at position 1921 is substituted by G (EMBL accession number M36968).
Stem sizes:
Loop sizes:
5 6
2 0 11
Position Paired:
1893-1897; 1906-1910
1900-1905; 1922-1927
Bracket view of structure:
           1880      1890      1900      1910      1920
     #      89|123456789|123456789|123456789|123456789|1234567
     $ 1878 GGGAAACUGGAAGGCGGGGCGAGCUGCAGCCCCAGUGAAUCAAAUGCAGC=1927
     % 1878 :::::::::::::::[[[[[::((((((]]]]]:::::::::::))))))

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1998-2-24/.../1999-2-3 PKB00004.html