Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TYMV

PKB-number: PKB5
Definition: tRNA-like structure from turnip yellow mosaic virus
Organism: turnip yellow mosaic virus
Abbreviation: TYMV
RNA type: Viral tRNA-like
Keywords: tymoviruses; aminoacylation; RNA 3'end
EMBL number: X16378
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: NMR; Structure probing; Sequence comparison; Mutagenesis
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem 1991, 201:303-324
[2] Mans RMW et al. J.Mol.Biol. 1992, 223:221-232
[3] Kolk MH et al. Science 1998, 280:434-438
Comment: This is the representative structure for a group of pseudoknots, that was extensively studied by several methods.
Stem sizes:
Loop sizes:
3 5
4 0 3
Position Paired:
6293-6295; 6305-6307
6300-6304; 6311-6315
Bracket view of structure:
           6280      6290      6300      6310
     #      89|123456789|123456789|123456789|12345678
     $ 6278 CGGGUGCAACUCCCGCCCCUCUUCCGAGGGUCAUCGGAACC=6318
     % 6278 :::::::::::::::(((::::[[[[[))):::]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-10 PKB00005.html