Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
KYMV-BP

PKB-number: PKB6
Definition: tRNA-like structure 3'end pseudoknot of kennedya yellow mosaic virus (strain Bawley Point)
Organism: kennedya yellow mosaic virus
Abbreviation: KYMV-BP
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: AF035199
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes:
3 6
3 0 3
Position Paired:
626-628; 638-640
632-637; 644-649
Bracket view of structure:
                  620       630       640       650
     #     123456789|123456789|123456789|123456789|12
     $ 611 GGGGUGCAACUCCCCCGUCUAUCCUGGACGUCACCAGGACCA=652
     % 611 :::::::::::::::(((:::[[[[[[))):::]]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-10 PKB0006.html