Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PhyMV

PKB-number: PKB8
Definition: tRNA-like structure 3'end pseudoknot of physalis mottle virus
Organism: physalis mottle virus
Abbreviation: PhyMV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: Y16104
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes:
3 6
2 0 2
Position Paired:
6648-6650; 6659-6661
6653-6658; 6664-6669
Bracket view of structure:
               6640      6650      6660      6670
     #      456789|123456789|123456789|123456789|123
     $ 6634 UGGGUGCAACUCCCCCCCCUUCCGUGGGUAACGGAAACCA=6673
     % 6634 ::::::::::::::(((::[[[[[[)))::]]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-10 PKB00008.html