Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
DYMV

PKB-number: PKB9
Definition: tRNA-like structure 3'end pseudoknot of desmodium yellow mottle virus
Organism: desmodium yellow mottle virus
Abbreviation: DYMV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: AF035201
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324
Stem sizes:
Loop sizes:
3 6
3 0 3
Position Paired:
662-664; 674-676
668-673; 680-685
Bracket view of structure:
            650       660       670       680
     #     789|123456789|123456789|123456789|12345678
     $ 647 GGGGUGCAACUCCCCCGUCUAUCCUGGACGUCACCAGGACCA=688
     % 647 :::::::::::::::(((:::[[[[[[))):::]]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-15 PKB00009.html