Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
OYMV

PKB-number: PKB10
Definition: tRNA-like structure 3'end pseudoknot of ononis yellow mosaic virus
Organism: ononis yellow mosaic virus
Abbreviation: OYMV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: J04375
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes:
3 6
3 0 2
Position Paired:
6186-6188; 6198-6200
6192-6197; 6203-6208
Bracket view of structure:
                 6180      6190      6200      6210
     #      23456789|123456789|123456789|123456789|1
     $ 6172 UGGGUUCAACUCCCCCCCUUUUCCGAGGGUAUCGGAAACC=6211
     % 6172 ::::::::::::::(((:::[[[[[[)))::]]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-16 PKB00010.html