Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
WCMV

PKB-number: PKB12
Definition: tRNA-like structure 3'end pseudoknot of wild cucumber mosaic virus
Organism: wild cucumber mosaic virus
Abbreviation: WCMV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: AF035633
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes:
3 5
3 0 3
Position Paired:
1354-1356; 1365-1367
1360-1364; 1371-1375
Bracket view of structure:
         1340      1350      1360      1370
     #      |123456789|123456789|123456789|123456789
     $ 1340 CGGGUGCAACCCCCCCUCCCCCCGUAGGUUAACGGGACCA=1379
     % 1340 ::::::::::::::(((:::[[[[[))):::]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-16 PKB00012.html