Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CaYVV

PKB-number: PKB13
Definition: tRNA-like structure 3'end pseudoknot of calopogonium yellow vein virus
Organism: calopogonium yellow vein virus
Abbreviation: CaYVV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: U91413
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes:
3 6
3 0 3
Position Paired:
670-672; 682-684
676-681; 688-693
Bracket view of structure:
              660       670       680       690
     #     56789|123456789|123456789|123456789|123456
     $ 655 GGGGUGCGACUCCCCCGUCUAUCCUGAACGUCAUCAGGACCA=696
     % 655 :::::::::::::::(((:::[[[[[[))):::]]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-16 PKB00013.html