Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
APLV

PKB-number: PKB14
Definition: tRNA-like structure 3'end pseudoknot of andean potato latent virus
Organism: andean potato latent virus
Abbreviation: APLV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: AF035402
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes:
3 6
2 0 2
Position Paired:
1680-1682; 1691-1693
1685-1690; 1696-1701
Bracket view of structure:
             1670      1680      1690      1700
     #      6789|123456789|123456789|123456789|12345
     $ 1666 CGGGUGCGACUCCCCCCCCUCCUGUGGGCUACAGGAACCA=1705
     % 1666 ::::::::::::::(((::[[[[[[)))::]]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-16 PKB00014.html