Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
EMV

PKB-number: PKB15
Definition: tRNA-like structure 3'end pseudoknot of eggplant mosaic virus
Organism: eggplant mosaic virus
Abbreviation: EMV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: J04374
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324
Stem sizes:
Loop sizes:
3 6
2 0 3
Position Paired:
6305-6307; 6316-6318
6310-6315; 6322-6327
Bracket view of structure:
                  6300      6310      6320     6330
     #      123456789|123456789|123456789|123456789|1
     $ 6291 UGGGUGCGACUCCCCCCCCUCCCGUGGGUCAACGGGAACCA=6331
     % 6291 ::::::::::::::(((::[[[[[[))):::]]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-16 PKB00015.html