Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
OMV

PKB-number: PKB16
Definition: tRNA-like structure 3'end pseudoknot of okra mosaic virus
Organism: okra mosaic virus
Abbreviation: OMV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: AF035202
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes:
3 6
3 0 3
Position Paired:
655-657; 667-669
661-666; 673-678
Bracket view of structure:
         640       650       660       670       680
     #     |123456789|123456789|123456789|123456789|1
     $ 640 GGGGUGCAACUCCCCCGCCCAUCUCGAGCGUCAUCGAGACCA=681
     % 640 :::::::::::::::(((:::[[[[[[))):::]]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-16 PKB00016.html