Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CcTMV

PKB-number: PKB17
Definition: tRNA-like structure 3'end pseudoknot of cowpea strain of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: CcTMV
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end; aminoacylation
EMBL number: J02413
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324
Comment: The 3'end of this tobamoviral RNA has structural similarity to the tymoviral structures and, in contrast to histidine-accepting tobamoviruses, is charged with valine.
This virus is also called: sunhemp mosaic virus (SHMV).
Stem sizes:
Loop sizes:
3 5
4 0 3
Position Paired:
1774-1776; 1786-1788
1781-1785; 1792-1796
Bracket view of structure:
          1760      1770      1780      1790      1800
     #      9|123456789|123456789|123456789|123456789|
     $ 1759 GGGGAGCAUUACCCCCCCAAAACCCUGGGGAUACAGGGCCCA=1800
     % 1759 :::::::::::::::(((::::[[[[[))):::]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 17-3-1999 PKB00017.html