Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMV

PKB-number: PKB18
Definition: tRNA-like structure 3'end pseudoknot of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: TMV
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: J02415
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; Structure probing
References: [1] Rietveld K et al., EMBO J.1984, 3:2613-2619.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Comment: This is the most extensively studied representative structure from tobamoviruses.
The sequence is given for the so-called "strain vulgare".
Stem sizes:
Loop sizes:
3 4
3 0 2
Position Paired:
6373-6375; 6383-6385
6379-6382; 6388-6391
Bracket view of structure:
           6360      6370      6380      6390
     #      89|123456789|123456789|123456789|12345
     $ 6358 GGGGUUCGAAUCCCCCCGUUACCCCCGGUAGGGGCCCA=6395
     % 6358 :::::::::::::::(((:::[[[[)))::]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-17 PKB00018.html