Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PMMV-I

PKB-number: PKB19
Definition: tRNA-like structure 3'end pseudoknot of pepper mild mottle virus (Italian strain)
Organism: pepper mild mottle virus
Abbreviation: PMMV-I
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: X72587
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes:
3 4
3 0 2
Position Paired:
677-679; 687-689
683-686; 692-695
Bracket view of structure:
                 670       680      690
     #     23456789|123456789|123456789|123456789
     $ 662 GGGGUUCGAAUCCCCCCCGAACCGCGGGUAGCGGCCCA=699
     % 662 :::::::::::::::(((:::[[[[)))::]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-17 PKB00019.html