Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CGMMV

PKB-number: PKB20
Definition: tRNA-like structure 3'end pseudoknot of cucumber green mottle mosaic virus
Organism: cucumber green mottle mosaic virus
Abbreviation: CGMMV
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: D12505
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes:
3 4
3 0 2
Position Paired:
6402-6404; 6412-6414
6408-6411; 6417-6420
Bracket view of structure:
            6390      6400      6410      6420
     #      789|123456789|123456789|123456789|1234
     $ 6387 GGGGUUCGAAUCCCCCCUUUUCCCCGGGUAGGGGCCCA=6424
     % 6387 :::::::::::::::(((:::[[[[)))::]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-17 PKB00020.html