Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMV-L

PKB-number: PKB21
Definition: tRNA-like structure 3'end pseudoknot of the tomato strain of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: TMV-L
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: X02144
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes:
3 4
3 0 2
Position Paired:
6362-6364; 6372-6374
6368-6371; 6377-6380
Bracket view of structure:
            6350      6360      6370      6380
     #      789|123456789|123456789|123456789|1234
     $ 6347 GGGAUUCGAAUUCCCCCGGAACCCCCGGUUGGGGCCCA=6384
     % 6347 :::::::::::::::(((:::[[[[)))::]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-17 PKB00021.html