Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
STMV

PKB-number: PKB22
Definition: tRNA-like structure 3'end pseudoknot of satellite tobacco mosaic virus
Organism: satellite tobacco mosaic virus
Abbreviation: STMV
RNA type: Viral tRNA-like
Keywords: satellite virus; RNA 3'end; aminoacylation
EMBL number: M25782
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; aminoacylation assays
References: [1] Gultyaev AP, van Batenburg E, Pleij CWA. J.Gen.Virol. 1994, 75:2851-2856.
[2] Felden B, Florentz C, McPherson A, Giege R. Nucleic Acids Res. 1994, 22:2882-2886.
Stem sizes:
Loop sizes:
3 4
3 0 3
Position Paired:
   1035-1037; 1045-1047
1041-1044; 1051-1054
Bracket view of structure:
         1020      1030      1040      1050
     #      |123456789|123456789|123456789|12345678
     $ 1020 GGGGUUCGAAUCCCUCCCUAACCGCGGGUAAGCGGCCCA=1058
     % 1020 :::::::::::::::(((:::[[[[))):::]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-23 PKB00022.html