Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMGMV

PKB-number: PKB23
Definition: tRNA-like structure 3'end pseudoknot of tobacco mild green mosaic virus
Organism: tobacco mild green mosaic virus
Abbreviation: TMGMV
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: M34077
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; Structure probing
References: [1] Garcia-Arenal F. Virology 1988, 167:201-206.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem. 1991, 201:303-324.
Comment: The nucleotide G-6335 seems to be misprinted in the entry (M34077) of the EMBL database as C, while this is G in the original article [1], which is consistent with a model of tRNA-like structure.
Stem sizes:
Loop sizes:
3 4
3 0 2
Position Paired:
6333-6335; 6343-6345
6339-6342; 6348-6351
Bracket view of structure:
           6320      6330      6340      6350
     #      89|123456789|123456789|123456789|12345
     $ 6318 GAGGUUCGAAUCCUCCCGUAACCGCCGGUAGCGGCCCA=6355
     % 6318 :::::::::::::::(((:::[[[[)))::]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-3-23 PKB00023.html