Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PaMMV

PKB-number: PKB24
Definition: tRNA-like structure 3'end pseudoknot of paprika mild mottle virus
Organism: paprika mild mottle virus
Abbreviation: PaMMV
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: X72586
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Garcia-Luque I et al. Arch.Virol.1993, 131:75-88.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Comment: Initially the virus was termed as P11 strain or Dutch isolate of pepper mild mottle virus (PMMV), but the term for a new virus paprika mild mottle virus (PaMMV) was proposed [1] on the basis of sequence comparisons.
Stem sizes:
Loop sizes:
3 4
3 0 3
Position Paired:
817-819; 827-829
823-826; 833-836
Bracket view of structure:
                 810       820       830       840
     #     23456789|123456789|123456789|123456789|
     $ 802 GGGGUUCGAAUCCCCCCUUUACCCCGGGUAUGGGGCCCA=840
     % 802 :::::::::::::::(((:::[[[[))):::]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 25-3-1999 PKB00024.html