Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ORMV

PKB-number: PKB26
Definition: tRNA-like structure 3'end pseudoknot of oilseed rape mosaic virus
Organism: oilseed rape mosaic virus
Abbreviation: ORMV
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: U30944
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Aguilar I. et al. Plant Mol. Biol. 1996, 30:191-197.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Comment: Initially this tobamovirus was called youcai mosaic virus, later as chinese rape mosaic virus; finally it was suggested [1] to change the name to oilseed rape mosaic virus (ORMV).
Stem sizes:
Loop sizes:
3 4
2 0 2
Position Paired:
6282-6284; 6291-6293
6287-6290; 6296-6299
Bracket view of structure:
            6270      6280      6290      6300
     #      789|123456789|123456789|123456789|123
     $ 6267 GAGGUUCGAAUCCUCCCUAACCCCGGGUAGGGGCCCA=6303
     % 6267 :::::::::::::::(((::[[[[)))::]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 31-3-1999 PKB00026.html