Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PMMV-S

PKB-number: PKB27
Definition: tRNA-like structure 3'end pseudoknot of pepper mild mottle virus, Spanish isolate
Organism: pepper mild mottle virus
Abbreviation: PMMV-S
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: M81413
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Avila-Rincon MJ et al. J.Gen.Virol.1989, 70:3025-3031.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes:
3 4
3 0 2
Position Paired:
6335-6337; 6345-6347
6341-6344; 6350-6353
Bracket view of structure:
         6320      6330      6340      6350
     #      |123456789|123456789|123456789|1234567
     $ 6320 GGGGUUCGAAUCCCCCCCGAACCGCGGGUAGCGGCCCA=6357
     % 6320 :::::::::::::::(((:::[[[[)))::]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-4-6 PKB00027.html