Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ORSV-S1

PKB-number: PKB28
Definition: tRNA-like structure 3'end pseudoknot of odontoglossum ringspot virus, Singapore isolate
Organism: odontoglossum ringspot virus
Abbreviation: ORSV-S1
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: U34586
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Chng CG et al., Gene 1996, 171:155-161.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes:
3 4
2 0 2
Position Paired:
6588-6590; 6597-6599
6593-6596; 6602-6605
Bracket view of structure:
                6580      6590      6600
     #      3456789|123456789|123456789|123456789
     $ 6573 GGGAUUCGAAUUCCCCCUUACCUCGGGUAGAGGCCCA=6609
     % 6573 :::::::::::::::(((::[[[[)))::]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-4-7 PKB00028.html