Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBWMV1

PKB-number: PKB30
Definition: tRNA-like structure 3'end pseudoknot of RNA1 of soil-borne wheat mosaic virus
Organism: soil-borne wheat mosaic virus
Abbreviation: SBWMV1
RNA type: Viral tRNA-like
Keywords: furovirus; RNA 3'end; aminoacylation
EMBL number: L07937
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; aminoacylation assays
References: [1] Shirako Y, Wilson TM. Virology 1993, 195:16-32.
[2] Goodwin JB, Dreher TW. Virology 1998, 246:170-178.
Stem sizes:
Loop sizes:
3 5
3 0 3
Position Paired:
7074-7076; 7085-7087
7080-7084; 7091-7095
Bracket view of structure:
          7060      7070      7080      7090
     #      9|123456789|123456789|123456789|123456789
     $ 7059 GGGGUUCAAAUCCCCCCCGAACCGGAGGGUUAUCCGGCCCA=7099
     % 7059 :::::::::::::::(((:::[[[[[))):::]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-4-8 PKB00030.html