Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBWMV2

PKB-number: PKB31
Definition: tRNA-like structure 3'end pseudoknot of RNA2 of soil-borne wheat mosaic virus
Organism: soil-borne wheat mosaic virus
Abbreviation: SBWMV2
RNA type: Viral tRNA-like
Keywords: furovirus; RNA 3'end; aminoacylation
EMBL number: X81639
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; aminoacylation assays
References: [1] Shirako Y, Wilson TM. Virology 1993, 195:16-32.
[2] Goodwin JB, Dreher TW. Virology 1998, 246:170-178.
Stem sizes:
Loop sizes:
3 5
3 0 3
Position Paired:
3568-3570; 3579-3581
3574-3578; 3585-3589
Bracket view of structure:
                3560      3570      3580      3590
     #      3456789|123456789|123456789|123456789|12
     $ 3553 GGGGUUCAAUUCCCCCCCCAUCCGGAGGGUUAUCCGGCCC=3592
     % 3553 :::::::::::::::(((:::[[[[[))):::]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-4-8 PKB00031.html