Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PMTV2

PKB-number: PKB32
Definition: tRNA-like structure 3'end pseudoknot of RNA2 of potato mop-top virus
Organism: potato mop-top virus
Abbreviation: PMTV2
RNA type: Viral tRNA-like
Keywords: furovirus; RNA 3'end; aminoacylation
EMBL number: D30753
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; aminoacylation assays
References: [1] Scott KP, Kashiwasaki S, Reavy B, Harrison BD. J.Gen.Virol. 1994, 75:3561-3568.
[2] Goodwin JB, Dreher TW. Virology 1998, 246:170-178.
Stem sizes:
Loop sizes:
3 6
2 0 2
Position Paired:
2938-2940; 2949-2951
2943-2948; 2954-2959
Bracket view of structure:
              2930      2940      2950      2960
     #      56789|123456789|123456789|123456789|12
     $ 2925 GGGUGCAACUCCCCCCCCCUUGGAGGGUAUCCAAGACC=2962
     % 2925 :::::::::::::(((::[[[[[[)))::]]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-4-8 PKB00032.html