Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PCV1

PKB-number: PKB33
Definition: tRNA-like structure 3'end pseudoknot of RNA1 of peanut clump virus
Organism: peanut clump virus
Abbreviation: PCV1
RNA type: Viral tRNA-like
Keywords: furovirus; 3'end; aminoacylation
EMBL number: X78602
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; aminoacylation assays
References: [1] Herzog E et al., J.Gen.Virol. 1994, 75:3147-3155.
[2] Goodwin JB, Dreher TW. Virology 1998, 246:170-178.
Stem sizes:
Loop sizes:
3 5
4 0 3
Position Paired:
5871-5873; 5883-5885
5878-5882; 5889-5893
Bracket view of structure:
           5860      5870      5880      5890
     #      89|123456789|123456789|123456789|1234567
     $ 5858 GGUGCAAAUCCCCCGCUGAAACGGAGCGAUAUCCGUCCCA=5897
     % 5858 :::::::::::::(((::::[[[[[))):::]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-4-9 PKB00033.html