Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PCV2

PKB-number: PKB34
Definition: tRNA-like structure 3'end pseudoknot of RNA2 of peanut clump virus
Organism: peanut clump virus
Abbreviation: PCV2
RNA type: Viral tRNA-like
Keywords: furovirus; RNA 3'end; aminoacylation
EMBL number: L07269
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; aminoacylation assays
References: [1] Manohar SK et al., Virology 1993, 195:33-41.
[2] Goodwin JB, Dreher TW. Virology 1998, 246:170-178.
Stem sizes:
Loop sizes:
3 5
4 0 3
Position Paired:
4478-4480; 4490-4492
4485-4489; 4496-4500
Bracket view of structure:
              4470      4480      4490      4500
     #      56789|123456789|123456789|123456789|1234
     $ 4465 GGUGCAAAUCCCCCGCUGAAACGGAGCGAUAUCCGUCCCA=4504
     % 4465 :::::::::::::(((::::[[[[[))):::]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-4-9 PKB00034.html