Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
IPCV1

PKB-number: PKB35
Definition: tRNA-like structure 3'end pseudoknot of RNA-1 of Indian peanut clump virus
Organism: Indian peanut clump virus
Abbreviation: IPCV1
RNA type: Viral tRNA-like
Keywords: furovirus; RNA 3'end; aminoacylation
EMBL number: X99149
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; aminoacylation assays
References: [1] Miller JS et al. Arch.Virol. 1996, 141:2301-2312.
[2] Goodwin JB, Dreher TW. Virology 1998, 246:170-178.
Stem sizes:
Loop sizes:
3 5
4 0 3
Position Paired:
5815-5817; 5827-5829
5822-5826; 5833-5837
Bracket view of structure:
                 5810      5820      5830      5840
     #      23456789|123456789|123456789|123456789|1
     $ 5802 GGUGCAAAUCCCCCGCCGAUACGGAGCGAUAUCCGUCCCA=5841
     % 5802 :::::::::::::(((::::[[[[[))):::]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-4-9 PKB00035.html