Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
BSBV2 |
PKB-number: | PKB37 |
Definition: | tRNA-like structure 3'end pseudoknot of RNA 2 of beet soil-borne virus |
Organism: | beet soil-borne virus |
Abbreviation: | BSBV2 |
RNA type: | Viral tRNA-like |
Keywords: | furovirus; RNA 3'end |
EMBL number: | U64512 |
Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
Supported by: | Sequence comparison |
References: |
[1] Koenig R. et al. J.Gen.Virol. 1997, 78:469-477.
[2] Koenig R. et al. J.Gen.Virol. 1998, 79:2027-2036. |
Stem sizes: Loop sizes: |
3 5 4 0 3 |
Position Paired: | 3429-3431; 3441-3443 3436-3440; 3447-3451 |
Bracket view of structure: |
3420 3430 3440 3450 # 456789|123456789|123456789|123456789|1234 $ 3414 GGGGUGCAAAUCCCCCCCUUAACUUGAGGGAAAUCAAGCCC=3454 % 3414 :::::::::::::::(((::::[[[[[))):::]]]]]:::