Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BSBV3

PKB-number: PKB38
Definition: tRNA-like structure 3'end pseudoknot of RNA 3 of beet soil-borne virus
Organism: beet soil-borne virus
Abbreviation: BSBV3
RNA type: Viral tRNA-like
Keywords: furovirus; RNA 3'end; aminoacylation
EMBL number: Z66493
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; aminoacylation assays
References: [1] Koenig R. et al. Virology 1996, 216:202-207.
[2] Koenig R. et al. J.Gen.Virol. 1998, 79:2027-2036.
[3] Goodwin JB, Dreher TW. Virology 1998, 246:170-178.
Stem sizes:
Loop sizes:
3 5
4 0 3
Position Paired:
2981-2983; 2993-2995
2988-2992; 2999-3003
Bracket view of structure:
             2970      2980      2990      3000
     #      6789|123456789|123456789|123456789|123456
     $ 2966 GGGGUGCAACUCCCCCCCUUAACUAGAGGGAAAUCUAGCCC=3006
     % 2966 :::::::::::::::(((::::[[[[[))):::]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-4-9 PKB00038.html