Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BVQ1

PKB-number: PKB39
Definition: tRNA-like structure 3'end pseudoknot of RNA 1 of beet virus Q
Organism: beet virus Q
Abbreviation: BVQ1
RNA type: Viral tRNA-like
Keywords: pomovirus; RNA 3'end
EMBL number: AJ223596
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. J.Gen.Virol.1998, 79:2027-2036.
Stem sizes:
Loop sizes:
3 5
3 0 3
Position Paired:
5978-5980; 5989-5991
5984-5988; 5995-5999
Bracket view of structure:
                5970      5980      5990      6000
     #      3456789|123456789|123456789|123456789|123
     $ 5963 GGGGUGCAAAUCCCCCCCUAACUUGAGGGAAAUCAAGCCCC=6003
     % 5963 :::::::::::::::(((:::[[[[[))):::]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-4-9 PKB00039.html