Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BVQ2

PKB-number: PKB40
Definition: tRNA-like structure 3'end pseudoknot of RNA 2 of beet virus Q
Organism: beet virus Q
Abbreviation: BVQ2
RNA type: Viral tRNA-like
Keywords: pomovirus; RNA 3'end
EMBL number: AJ223597
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. J.Gen.Virol. 1998, 79:2027-2036.
Stem sizes:
Loop sizes:
3 5
3 0 3
Position Paired:
2889-2891; 2900-2902
2895-2899; 2906-2910
Bracket view of structure:
               2880      2890      2900      2910
     #      456789|123456789|123456789|123456789|123
     $ 2874 GGGGUGCAAAUCCCCCCCUAACUUGAGGGAAAUCAAGCCC=2913
     % 2874 :::::::::::::::(((:::[[[[[))):::]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-4-9 PKB00040.html