Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PEMV

PKB-number: PKB45
Definition: ORF2/ORF3 (putative RNA-dependent RNA polymerase) ribosomal frameshift site of pea enation mosaic virus
Organism: pea enation mosaic virus
Abbreviation: PEMV
RNA type: Viral Frameshift
Keywords: enamovirus; ribosomal frameshifting; RNA polymerase
EMBL number: L04573
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Demler SA; de Zoeten GA. J.Gen.Virol.1991, 72:1819-1834.
[2] ten Dam EB. (1995). Ph.D.Thesis, Leiden University.
Stem sizes:
Loop sizes:
6 4
2 0 6
Position Paired:
2042-2047; 2054-2059
2050-2053; 2066-2069
Bracket view of structure:
          2030      2040      2050      2060
     #      9|123456789|123456789|123456789|123456789
     $ 2029 GGGAAACGGAUUAUUCCGGUCGACUCCGGAGAAACAAAGUC=2069
     % 2029 :::::::::::::((((((::[[[[))))))::::::]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-12 PKB00045.html