Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Ec_PK1

PKB-number: PKB49
Definition: Pseudoknot PK1 of E.coli tmRNA
Organism: E.coli
Abbreviation: Ec_PK1
RNA type: tmRNA
Keywords: trans-translation; peptide tagging; tmRNA
EMBL number: U68074
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing
References: [1] Williams KP & Bartel DP. (1996). RNA 2:1306-1310.
[2] Felden B. et al. (1997). RNA 3:89-103.
[3] Nameki N. et al. (1999). J.Mol.Biol. 286:733-744.
[4] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna/).
[5] Zwieb C. & Wower J. (2000). Nucleic Acids Res. 28:169-170.
Stem sizes:
Loop sizes:
5 6
1 2 5
Position Paired:
49-53; 63-67
55-60; 73-78
Bracket view of structure:
          50        60        70
     #    9|123456789|123456789|12345678
     $ 49 CGAGGGGCGGUUGGCCUCGUAAAAAGCCGC=78
     % 49 (((((:[[[[[[::))))):::::]]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-20/.../1999-12-23 PKB00049.html