Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Ec_PK2

PKB-number: PKB50
Definition: Pseudoknot PK2 of E.coli tmRNA
Organism: E.coli
Abbreviation: Ec_PK2
RNA type: tmRNA
Keywords: trans-translation; peptide tagging; tmRNA
EMBL number: U68074
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; Structure probing
References: [1] Williams KP & Bartel DP. (1996). RNA 2:1306-1310.
[2] Felden B. et al. (1997). RNA 3:89-103.
[3] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna/).
[4] Zwieb C. & Wower J. (2000). Nucleic Acids Res. 28:169-170.
Stem sizes:
Loop sizes:
14 5
3 0 10
Position Paired:
138-144; 175-181
145-148; 167-170
151-153; 162-164
157-161; 192-196
Bracket view of structure:
           140       150       160       170       180       190
     #     89|123456789|123456789|123456789|123456789|123456789|123456
     $ 138 CCUCUCUCCCUAGCCUCCGCUCUUAGGACGGGGAUCAAGAGAGGUCAAACCCAAAAGAG=196
     % 138 (((((((((((::(((:::[[[[[)))::))))::::)))))))::::::::::]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-20/.../1999-12-23 PKB00050.html