Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Ec_PK4

PKB-number: PKB52
Definition: Pseudoknot PK4 of E.coli tmRNA
Organism: E.coli
Abbreviation: Ec_PK4
RNA type: tmRNA
Keywords: trans-translation; peptide tagging; tmRNA
EMBL number: U68074
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; Structure probing
References: [1] Williams KP & Bartel DP. (1996). RNA 2:1306-1310.
[2] Felden B. et al. (1997). RNA 3:89-103.
[3] Hickerson RP et al. (1998). J.Mol.Biol. 279:577-587.
[4] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna/).
[5] Zwieb C. & Wower J. (2000). Nucleic Acids Res. 28:169-170.
Stem sizes:
Loop sizes:
13 6
1 0 9
Position Paired:
248-257; 274-283
259-261; 270-272
263-265; 297-299
267-269; 293-295
Bracket view of structure:
           250       260       270       280       290
     #     89|123456789|123456789|123456789|123456789|123456789
     $ 248 GUUUGUUAGUGGCGUGUCCGUCCGCAGCUGGCAAGCGAAUGUAAAGACUGAC=299
     % 248 ((((((((((:(((:[[[:[[[))):)))))))))):::::::::]]]:]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-20/.../1999-12-23 PKB00052.html