Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMV_UPD-PK1

PKB-number: PKB53
Definition: Pseudoknot PK1 of the upstream pseudoknot domain (UPD) of 3'-UTR of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: TMV_UPD-PK1
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: J02415
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing
References: [1] van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
[3] Felden B. et al. (1996). RNA 2:201-212.
Comment: This is the most extensively studied representative structure from tobamoviruses. The sequence is given for the so-called "strain vulgare".
Stem sizes:
Loop sizes:
3 4
1 0 5
Position Paired:
6218-6220; 6226-6228
6222-6225; 6234-6237
Bracket view of structure:
             6220      6230
     #      6789|123456789|1234567
     $ 6216 ACGGAUUGUGUCCGUAAUCACA=6237
     % 6216 ::(((:[[[[))):::::]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-26 PKB00053.html