Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMV_UPD-PK2

PKB-number: PKB54
Definition: Pseudoknot PK2 of the upstream pseudoknot domain (UPD) of the 3'UTR of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: TMV_UPD-PK2
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: J02415
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing
References: [1] Van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
[3] Felden B. et al. (1996). RNA 2:201-212.
Comment: This is the most extensively studied representative structure from tobamoviruses. The sequence is given for the so-called "strain vulgare".
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
6238-6240; 6248-6250
6242-6247; 6254-6259
Bracket view of structure:
           6240      6250
     #      89|123456789|123456789
     $ 6238 CGUGGUGCGUACGAUAACGCAU=6259
     % 6238 (((:[[[[[[))):::]]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-26 PKB00054.html