Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMV_UPD-PK3

PKB-number: PKB55
Definition: Pseudoknot PK3 of the upstream pseudoknot domain (UPD) of the 3'-UTR of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: TMV_UPD-PK3
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: J02415
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing
References: [1] Van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
[3] Felden B. et al. (1996). RNA 2:201-212.
Comment: This is the most extensively studied representative structure from tobamoviruses. The sequence is given for the so-called "strain vulgare".
Stem sizes:
Loop sizes:
4 5
5 0 6
Position Paired:
6260-6263; 6274-6277
6269-6272; 6286-6289
6273-6273; 6284-6284
Bracket view of structure:
         6260      6270      6280
     #      |123456789|123456789|123456789
     $ 6260 AGUGUUUUUCCCUCCACUUAAAUCGAAGGG=6289
     % 6260 ((((:::::[[[[[))))::::::]:]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-26 PKB00055.html