Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ORSV-S1_UPD3-PK1

PKB-number: PKB56
Definition: Pseudoknot PK1 of the upstream pseudoknot domain (UPD3) of the 3'-UTR of odontoglossum ringspot virus, Singapore isolate
Organism: odontoglossum ringspot virus
Abbreviation: ORSV-S1_UPD3-PK1
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: U34586
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Chng C.G. et al. (1996). Gene 171:155-161.
[2] Gultyaev A.P. et al. (1994). J.Gen.Virol. 75:2851-2856.
Comment: The 3'-UTR of ORSV RNA contains three (slightly different) upstream pseudoknot domains (UPD1, UPD2 and UPD3, numbered from the 3'end). The UPD3 consists of the pseudoknots PK1, PK2, and PK3, numbered in the 5'-3' direction.
Stem sizes:
Loop sizes:
6 4
1 0 3
Position Paired:
6213-6218; 6224-6229
6220-6223; 6233-6236
Bracket view of structure:
                6220      6230
     #      3456789|123456789|123456
     $ 6213 UAACGUUGAUAGUGUUGAACUAUC=6236
     % 6213 ((((((:[[[[)))))):::]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-26 PKB00056.html