Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ORSV-S1_UPD1-PK2

PKB-number: PKB59
Definition: Pseudoknot PK2 of the upstream pseudoknot domain (UPD1) of the 3'-UTR of odontoglossum ringspot virus, Singapore isolate
Organism: odontoglossum ringspot virus
Abbreviation: ORSV-S1_UPD1-PK2
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: U34586
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Chng C.G. et el. (1996). Gene 171:155-161.
[2] Gultyaev A.P. et al. (1994). J.Gen.Virol. 75:2851-2856.
Comment: The 3'-UTR of ORSV RNA contains three (slightly different) upstream pseudoknot domains (UPD1, UPD2 and UPD3, numbered from the 3'end). The UPD1 includes only PK2 and PK3; there is no homologue of PK1 (present in the UPD3).
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
6451-6453; 6461-6463
6455-6460; 6467-6472
Bracket view of structure:
                  6460      6470
     #      123456789|123456789|12
     $ 6451 CGUGGUGCAUACGAUAAUGCAU=6472
     % 6451 (((:[[[[[[))):::]]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-27 PKB00059.html