Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ORSV-S1_UPD2-PK3

PKB-number: PKB60
Definition: Pseudoknot PK3 of the upstream pseudoknot domain (UPD2) of the 3'-UTR of odontoglossum ringspot virus, Singapore isolate
Organism: odontoglossum ringspot virus
Abbreviation: ORSV-S1_UPD2-PK3
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: U34586
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Chng C.G. et al. (1996). Gene 171:155-161.
[2] Gultyaev A.P. et al. (1994). J.Gen.Virol. 75:2851-2856.
Comment: The 3'-UTR of ORSV RNA contains three (slightly different) upstream pseudoknot domains (UPD1, UPD2 and UPD3, numbered from the 3'end). The UPD2 includes only PK2 and PK3; there is no homologue of PK1 (present in the UPD3).
Stem sizes:
Loop sizes:
4 5
5 0 6
Position Paired:
6362-6365; 6376-6379
6371-6374; 6388-6391
6375-6375; 6386-6386
Bracket view of structure:
                 6370      6380      6390
     #      23456789|123456789|123456789|1
     $ 6362 AGUGUUUAUCCCUCCACUUGAAUCGAAGGG=6391
     % 6362 ((((:::::[[[[[))))::::::]:]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-27 PKB00060.html