Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
ORSV-S1_UPD3-PK3 |
PKB-number: | PKB62 |
Definition: | Pseudoknot PK3 of the upstream pseudoknot domain (UPD3) of the 3'-UTR of odontoglossum ringspot virus, Singapore isolate |
Organism: | odontoglossum ringspot virus |
Abbreviation: | ORSV-S1_UPD3-PK3 |
RNA type: | Viral 3 UTR |
Keywords: | tobamovirus; translational regulation |
EMBL number: | U34586 |
Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
Supported by: | Sequence comparison |
References: |
[1] Chng C.G. et al. (1996). Gene 171:155-161.
[2] Gultyaev A.P. et al. (1994). J.Gen.Virol. 75:2851-2856. |
Comment: | The 3'-UTR of ORSV RNA contains three (slightly different) upstream pseudoknot domains (UPD1, UPD2 and UPD3, numbered from the 3'end). The UPD3 consists of the pseudoknots PK1, PK2 and PK3, numbered in the 5'-3' direction. |
Stem sizes: Loop sizes: |
4 5 5 0 6 |
Position Paired: | 6259-6262; 6273-6276 6268-6271; 6285-6288 6272-6272; 6283-6283 |
Bracket view of structure: |
6260 6270 6280 # 9|123456789|123456789|12345678 $ 6259 AGUGGUUAUCCCUCCACUUAAAUCGAAGGG=6288 % 6259 ((((:::::[[[[[))))::::::]:]]]]