Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ORSV-S1_UPD3-PK3

PKB-number: PKB62
Definition: Pseudoknot PK3 of the upstream pseudoknot domain (UPD3) of the 3'-UTR of odontoglossum ringspot virus, Singapore isolate
Organism: odontoglossum ringspot virus
Abbreviation: ORSV-S1_UPD3-PK3
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: U34586
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Chng C.G. et al. (1996). Gene 171:155-161.
[2] Gultyaev A.P. et al. (1994). J.Gen.Virol. 75:2851-2856.
Comment: The 3'-UTR of ORSV RNA contains three (slightly different) upstream pseudoknot domains (UPD1, UPD2 and UPD3, numbered from the 3'end). The UPD3 consists of the pseudoknots PK1, PK2 and PK3, numbered in the 5'-3' direction.
Stem sizes:
Loop sizes:
4 5
5 0 6
Position Paired:
6259-6262; 6273-6276
6268-6271; 6285-6288
6272-6272; 6283-6283
Bracket view of structure:
          6260      6270      6280
     #      9|123456789|123456789|12345678
     $ 6259 AGUGGUUAUCCCUCCACUUAAAUCGAAGGG=6288
     % 6259 ((((:::::[[[[[))))::::::]:]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-27 PKB00062.html