Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ORSV-S1_UPD3-PK2

PKB-number: PKB63
Definition: Pseudoknot PK2 of the upstream pseudoknot domain (UPD3) of the 3'-UTR of odontoglossum ringspot virus, Singapore isolate
Organism: odontoglossum ringspot virus
Abbreviation: ORSV-S1_UPD3-PK2
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: U34586
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Chng C.G. et al. (1996). Gene 171:155-161.
[2] Gultyaev A.P. et al. (1994). J.Gen.Virol. 75:2851-2856.
Comment: The 3'-UTR of ORSV RNA contains three (slightly different) upstream pseudoknot domains (UPD1, UPD2 and UPD3, numbered from the 3'end). The UPD3 consists of the pseudoknots PK1, PK2 and PK3, numbered in the 5'-3' direction.
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
6237-6239; 6247-6249
6241-6246; 6253-6258
Bracket view of structure:
            6240      6250
     #      789|123456789|12345678
     $ 6237 CGUGGUGCAUACGAUAAUGCAU=6258
     % 6237 (((:[[[[[[))):::]]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-27 PKB00063.html