Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Ec_16S-PK505/526

PKB-number: PKB65
Definition: The pseudoknot 505-507/524-526 of 16S ribosomal RNA of E.coli
Organism: E.coli
Abbreviation: Ec_16S-PK505/526
RNA type: rRNA
Keywords: ribosome; translation; rRNA
EMBL number: E05133
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison
References: [1] Woese C.R. & Gutell R.R. (1989). Proc.Natl.Acad.Sci.USA 86:3119-3122.
[2] Powers T. & Noller H.F. (1991). EMBO J. 10:2203-2214.
[3] Gutell R.R. (1993). Curr.Opin.Struct.Biol. 3:313-322.
[4] Van de Peer Y. et al. (1999). Nucleic Acids Res. 27:179-183. (database: http://rrna.uia.ac.be/ssu/)
Comment: The pseudoknot was suggested on the basis of phylogenetic comparisons [1] and supported by mutagenesis [2] to be important for ribosome functioning. The pseudoknot is conserved in other 16S-like rRNAs: for review see e.g. [3], the database of small subunit rRNAs [4].
Stem sizes:
Loop sizes:
3 7
3 6 7
Position Paired:
500-504; 541-545
505-507; 524-526
511-517; 534-540
Bracket view of structure:
         500       510       520       530       540
     #     |123456789|123456789|123456789|123456789|12345
     $ 500 GCACCGGCUAACUCCGUGCCAGCAGCCGCGGUAAUACGGAGGGUGC=545
     % 500 ((((((((:::[[[[[[[::::::))):::::::]]]]]]])))))

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-1 PKB00065.html