Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Lp_PK2

PKB-number: PKB68
Definition: Pseudoknot PK2 of Legionella pneumophila tmRNA
Organism: Legionella pneumophila
Abbreviation: Lp_PK2
RNA type: tmRNA
Keywords: trans-translation; peptide tagging; tmRNA
EMBL number: U68079
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Williams K.P. & Bartel D.P. (1996). RNA 2:1306-1310.
[2] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna/).
[3] Zwieb C. & Wower J. (2000). Nucleic Acids Res. 28:169-170. (tmRNA database: http://psyche.uthct.edu/dbs/tmRDB/tmRDB.html).
Stem sizes:
Loop sizes:
10 7
1 10 12
Position Paired:
149-151; 195-197
153-155; 191-193
160-163; 182-185
165-171; 210-216
Bracket view of structure:
          150       160       170       180       190       200       210
     #     9|123456789|123456789|123456789|123456789|123456789|123456789|123456
     $ 149 GUUAAACCAUCACUGUGUACUGGCCAAUAAACCCAGUAUCCCGUUCGACCGAGCCCGCUUAUCGGUAU=216
     % 149 (((:(((::::((((:[[[[[[[::::::::::)))):::::))):)))::::::::::::]]]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-8/.../1999-12-23 PKB00068.html