Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Lp_PK3

PKB-number: PKB69
Definition: Pseudoknot PK3 of Legionella pneumophila tmRNA
Organism: Legionella pneumophila
Abbreviation: Lp_PK3
RNA type: tmRNA
Keywords: trans-translation; peptide tagging; tmRNA
EMBL number: U68079
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Williams K.P. & Bartel D.P. (1996). RNA 2:1306-1310.
[2] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna/).
[3] Zwieb C. & Wower J. (2000). Nucleic Acids Res. 28:169-170. (tmRNA database: http://psyche.uthct.edu/dbs/tmRDB/tmRDB.html).
Stem sizes:
Loop sizes:
9 7
24 0 3
Position Paired:
225-226; 273-274
227-233; 265-271
258-261; 282-285
262-264; 278-280
Bracket view of structure:
              230       240       250       260       270       280
     #     56789|123456789|123456789|123456789|123456789|123456789|12345
     $ 225 CGGUCAUAAGAGAUAAGCUAGCGUCCUAAUCUAUCCCGGGUUAUGGCGCGAAACUCAGGGA=285
     % 225 (((((((((::::::::::::::::::::::::[[[[[[[))))))):)):::]]]:]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-8/.../1999-12-23 PKB00069.html